Where we have distributed the resources developed in the lab: Purified Protein Availability Traptavidin purified protein is available here. SpyCatcher, Cys-SpyCatcher and SUMO-SpyTag purified proteins are available here. Please enquire about availability of protein for monovalent streptavidin, divalent streptavidins and SpyAvidins. Plasmids The following plasmids were given to the plasmid repository Addgene for easy distribution to academic laboratories. For those in the UK, we can send plasmids to you directly if you prefer. Non-academics should contact Mark or our technology transfer office, Oxford University Innovation. Feel free to e-mail for comments or advice on these systems. (a) Biotin binding tools  (i) Traptavidin, a mutant of streptavidin with lower off-rate, increased thermostability, and greater mechanical strength. Also Traptavidin-E6 (for ion-exchange chromatography purification) (ii) Monovalent streptavidin and cis or trans Divalent streptavidin: Alive-H6 (biotin binding with 6 histidines for Ni-NTA purification) Alive-E6 (biotin binding with 6 glutamates for ion-exchange purification) Dead (streptavidin subunit with no biotin binding) Dead-Aspartate loop (streptavidin subunit with no biotin binding and negatively charged loop for ion-exchange chromatography resolution) (J Mol Biol 2014 and Nature Methods 2006) (iii) SpyAvidin subunits: see below (iv) Biotinylation tools pDisplay-BirA-ER for biotinylation in the mammalian secretory pathway pDisplay-AP-CFP-TM as a target for BirA in mammalian cells BirA-His6 for bacterial overexpression (GST-BirA for bacterial overexpression- please request from Chris O’Callaghan) (b) Isopeptide tools SpyTag cloning NOTE! If SpyTag is positioned right next to the initiation codon, with certain codon usage we found poor induction in bacteria. This is probably because of secondary structure formation with vector-derived sequences in the mRNA . The codons below worked well for these two common promoter systems: T7 vector             gcacacatagtaatggtagacgcctacaagccgacgaag T5 vector             gctcatatcgtcatggttgacgcgtataaaccgaccaaa                        A  H  I  V  M  V  D  A  Y  K  P  T  K Ideally you should check your particular construct using an online Ribosome Binding Site calculator, with 10,000 representing a satisfactory score. (i) Standard SpyTag/SpyCatcher tools SpyTag-MBP for irreversible peptide-protein ligation SpyCatcher for irreversible peptide-protein ligation SpyCatcher EQ as a non-reactive control for SpyCatcher MBPx-SpyCatcher for anchoring on amylose-resin AviTag-SpyCatcher for anchoring on streptavidin-resin (ii) SpyLigase tools SpyLigase for peptide-peptide ligation SUMO-KTag as a positive-control substrate for SpyLigase (iii) SpyAvidin subunits: Dead-SpyCatcher (DCatch) Dead-SpyTag, (DTag) Traptavidin-E6 (Tre) Traptavidin (Tr) (iv) SpyRings: SpyTag-β-lactamase-SpyCatcher, for enzyme cyclization: through CPEC one can insert other enzymes in this scaffold (v) Solid-phase polyproteam synthesis: SnoopCatcher for irreversible peptide-protein ligation (an orthogonal pair to SpyTag/SpyCatcher) SnoopTag-MBP for irreversible peptide-protein ligation (an orthogonal pair to SpyTag/SpyCatcher) SpyCatcher-SnoopCatcher for bridging SpyTag and SnoopTag MBPx-SpyCatcher for solid-phase anchoring on amylose-resin AviTag-SpyCatcher for solid-phase anchoring on streptavidin-resin SnoopTag-mEGFP-SpyTag, with BamHI sites for easy insertion of other proteins between SnoopTag and SpyTag (Of course, please enquire if there is a useful plasmid on which we have published, that is not listed here.)
  2016 Howarth Lab. All rights reserved.
Reagent distribution
Home Research Publications Team Contact/Join Teaching Links Reagent distribution