Where we have distributed the resources developed in the lab: Proteins Monovalent streptavidin protein (J Mol Biol 2014 and Nature Methods 2006) is available for the academic community as a resource from our lab. There is no need to collaborate and no price charged for the materials, but you will need to pay for shipping. Please e-mail Mark with a very brief description of the application and why you expect that regular streptavidin will not suffice. Traptavidin protein is available here. Plasmids The following plasmids we have given to the plasmid repository Addgene for easy distribution to academic laboratories. For those in the UK, we can send plasmids to you directly if you prefer. Non-academics should contact Mark or the Oxford University technology transfer office, Isis Innovation. Feel free to e-mail for comments or advice on these systems. Traptavidin, a mutant of streptavidin with lower off-rate, increased thermostability, and greater mechanical strength. Monovalent streptavidin and cis or trans Divalent streptavidin: Alive-H6 or Alive-E6 and Dead or Dead-Aspartate loop  subunits (J Mol Biol 2014 and Nature Methods 2006) SpyTag cloning NOTE! If SpyTag is positioned right next to the initiation codon, with certain codon usage we found poor induction in bacteria. This is probably because of secondary structure formation with vector-derived sequences in the mRNA . The codons below worked well for these two common promoter systems: T7 vector             gcacacatagtaatggtagacgcctacaagccgacgaag T5 vector             gctcatatcgtcatggttgacgcgtataaaccgaccaaa                        A  H  I  V  M  V  D  A  Y  K  P  T  K Ideally you should check your particular construct using an online Ribosome Binding Site calculator, with 10,000 representing a satisfactory score. SpyAvidin subunits: Dead-SpyCatcher, Dead-SpyTag, Traptavidin-E6 SpyTag-MBP for irreversible peptide-protein ligation SpyCatcher for irreversible peptide-protein ligation SpyCatcher EQ as a non-reactive control for SpyCatcher SpyLigase for peptide-peptide ligation, and SUMO-KTag as a positive-control substrate for SpyLigase SpyTag-β-lactamase-SpyCatcher, for enzyme cyclization: through CPEC one can insert other enzymes in this scaffold (Of course, please enquire if there is a useful plasmid that we have published on that is not listed here.)
  2015 Howarth Lab. All rights reserved.
Reagent distribution
Home Research Publications Team Contact Teaching Links Reagent distribution